rs8064242 chr17:61414628 C>T
- Sequence
gctcagagcccaagtccagcaggc[C/T]cgggggagggtggcctcatggctc
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | -0.29 | 0.83 | 1.99 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Esophagus_Mucosa, Heart_Atrial_Appendage, Lung, Nerve_Tibial