rs806794 chr6:26200449 A>G
- Sequence
aaaaatgtgaacacccgagcctgg[A/G]tgcagcactaataatcaacattgt
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.54 | 1.00 | 2.97 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI height, hip circumference, hip circumference adjusted for bmi, parental longevity (combined parental attained age, martingale residuals), waist circumference, waist circumference adjusted for bmi (joint analysis main effects and physical activity interaction), waist circumference adjusted for bmi in active individuals, waist circumference adjusted for body mass index
GRASP age at first tooth, gene expression, hdl cholesterol, height, height tails (upper and lower 5th percentiles), homa-b, infant head circumference, intracranial volume, mean corpuscular hemoglobin concentration (mchc), mean corpuscular volume (mcv), number of teeth
GTEx eQTL Cells_Cultured_fibroblasts, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood