rs80693 chr22:32904362 G>T
- Sequence
cctcccttggctagcagatgcaga[G/T]agtctgcagagggctctgagtacc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- ZN143_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN143_HUMAN | -0.14 | 1.32 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, ldl cholesterol, microalbuminuria, suicide attempts in bipolar disorder (substance abuse/dependence), urinary albumin-to-creatinine ratio