rs8070 chr3:112013761 G>A
- Sequence
gaactatgcaaagactccgcttcc[G/A]ttttcctgagctcctcgggcccca
- ASB in cell types
- RWPE1 (prostate epithelial cells) RWPE2 epidermal keratinocytes
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| RWPE1 (prostate epithelial cells) | 2.71 | -2.78 | 1.00 | |||
| RWPE2 | 1.38 | -1.38 | 1.00 | |||
| epidermal keratinocytes | 1.72 | -0.16 | 2.00 |
Items per page:
1 – 3 of 3