rs8071653 chr17:61534680 G>T
- Sequence
ggtcttgtaaagagtcaattatgg[G/T]atacttctgatttgatccacatgc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | n/a | 1.42 | 6.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, diastolic blood pressure (dbp), height, ldl cholesterol, total cholesterol change with statins