rs8071815 chr17:49910852 A>C
- Sequence
tctgctactaggcttggtcacctt[A/C]ggcaaatctccttccctctctggg
- ASB in cell types
- T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 1.04 | -0.27 | 1.60 |
Items per page:
1 – 1 of 1