rs807787 chr4:40150036 A>G
- Sequence
ctagtgcatgctgccacctgtggt[A/G]gtctgtagttactgtcagtcacca
- ASB in cell types
- foreskin keratinocyte PC9 (lung adenocarcinoma) OCI-LY7 (diffuse large B-cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.43 | n/a | 2.50 | |||
| PC9 (lung adenocarcinoma) | 1.59 | -2.75 | 2.00 | |||
| OCI-LY7 (diffuse large B-cell lymphoma) | 1.08 | -0.24 | 1.33 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, fasting blood glucose, hip bone mineral density (bmd), homa-ir, maternal transmission distortion, microalbuminuria, paternal transmission distortion, spine bone mineral density (bmd), stabilized warfarin dose, transmission distortion
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis