rs8078243 chr17:75036706 C>A
- Sequence
ccaagtaaactgcattttttctca[C/A]atccctgcgctttcacttggctgt
- ASB in cell types
- A549 (lung carcinoma) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 1.32 | -1.16 | 3.00 | |||
| HepG2 (hepatoblastoma) | -0.33 | 0.69 | 1.96 |
Items per page:
1 – 2 of 2