rs807846 chr6:21297845 T>C
- Sequence
atgagagagtacctgcagagtatg[T/C]gcagatctgagctaaattcatgtg
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- RFX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RFX1_HUMAN | 0.87 | 2.06 | 2.67 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, birth weight, coronary artery disease (cad), hostility (left amygdala activation), irritible bowel syndrome, major depressive disorder, maternal transmission distortion, schizophrenia, transmission distortion, triglycerides, waist hip ratio