rs8082359 chr17:57213482 A>T
- Sequence
agttccaactgaactgcggggacc[A/T]aatgtgagaagggtggttccctga
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.75 | 0.13 | 1.51 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, birth weight, college completion, diastolic blood pressure (dbp), height, ldl cholesterol change with statins, major depressive disorder, neuroticism, years of education