rs8093327 chr18:7872841 T>A
- Sequence
ggttgtgtaagctcagagaattgg[T/A]catctgttttgaataatttgatct
- ASB in cell types
- coronary artery smooth muscle A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| coronary artery smooth muscle | 1.56 | -0.75 | 1.33 | |||
| A549 (lung carcinoma) | 0.48 | 0.56 | 1.23 |
Items per page:
1 – 2 of 2