rs8109162 chr19:2309035 G>A
- Sequence
acaggtgtgagccaccgcccggct[G/A]cctgcactgtttggtctgccgcac
- ASB in cell types
- HEK293 (embryonic kidney) keratinocytes
- ASB for transcription factors
- SNAI2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SNAI2_HUMAN | -0.73 | 1.62 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Brain_Putamen_basal_ganglia, Lung, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid