rs8112408 chr19:2550040 T>G
- Sequence
ccccaggaagtgccgaggcctctt[T/G]ccgctctcagtggaaaagggaaat
- ASB in cell types
- CD14+ monocytes monocyte-derived dendritic cells periferal blood macrophages
- ASB for transcription factors
- STAT1_HUMAN SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 1.74 | n/a | 2.50 | n/a | No Hit | |||
| SPI1_HUMAN | 1.87 | 0.55 | 2.04 | n/a | No Hit |
Items per page:
1 – 2 of 2