rs8112853 chr19:35531450 G>C
- Sequence
gctgcgtgtcaacctgctgtgcag[G/C]tgatggtgcctgcctgtgagtcac
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | -0.17 | 1.00 | 2.05 | -3.56 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP aortic valve calcium, chronic kidney disease, infant head circumference, major depressive disorder (narrow definition), major depressive disorder (narrow definition) (males), recurrent early onset major depressive disorder, recurrent early onset major depressive disorder (males), serum creatinine
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Liver, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis