rs8127823 chr21:40386347 G>A
- Sequence
ttcagattccgaagctttagttga[G/A]ggcagttgaagaacctacaaggct
- ASB in cell types
- KMS-11 neural cell SK-N-SH (neuroblastoma) MM1.S (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| KMS-11 | 2.49 | -2.54 | 1.33 | |||
| neural cell | 1.74 | n/a | 1.00 | |||
| SK-N-SH (neuroblastoma) | 1.77 | n/a | 1.33 | |||
| MM1.S (plasma cell myeloma) | -0.67 | 1.42 | 2.17 |
Items per page:
1 – 4 of 4