rs8137243 chr22:46047955 C>T
- Sequence
cagaaaaagcactgcaaatgctca[C/T]gcatgtttttacagaacagagccc
- ASB in cell types
- CD14+ monocytes
- ASB for transcription factors
- STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 1.51 | -3.02 | 2.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, cystatin c in serum, diastolic blood pressure (dbp), plasma aldosterone concentration corrected by plasma renin activity, premature ovarian failure, salmonella-induced pyroptosis, stabilized warfarin dose, systolic blood pressure (sbp)
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Cells_Cultured_fibroblasts, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Whole_Blood