rs8139990 chr22:46105475 G>T
- Sequence
tggaccccacggtggcctgtgttc[G/T]ccacgtggccgtgggtcagttcct
- ASB in cell types
- HEK293 (embryonic kidney) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.86 | 0.14 | 1.93 | |||
| foreskin keratinocyte | -3.04 | 1.69 | 2.50 |
Items per page:
1 – 2 of 2