rs815540 chr3:55483019 A>G
- Sequence
gtgcactttccaagcttcgcggcg[A/G]gcggggcgcgtggggcggggctca
- ASB in cell types
- H1 (embryonic stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| H1 (embryonic stem cells) | 1.14 | -0.80 | 1.33 |
Items per page:
1 – 1 of 1