rs815847 chr9:81607703 G>A
- Sequence
ggcaaccacagataggaaatgctc[G/A]caagtgccccaaggacctcccagg
- ASB in cell types
- CD34+ hematopoietic stem cells-derived proerythroblasts
- ASB for transcription factors
- GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA1_HUMAN | 1.47 | -1.36 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1