rs815946 chr7:55447126 T>C
- Sequence
aattcatcaaccaaaactgtgtca[T/C]gtgatgcccctgctgcaagggaga
- ASB in cell types
- 501Mel-Cl8 (melanoma)
- ASB for transcription factors
- MITF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MITF_HUMAN | -0.91 | 2.06 | 1.75 | 6.85 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP age at death with kuru exposure, fasting blood glucose, late onset alzheimers disease, obesity with early age of onset (age >2), premature ovarian failure, transmission distortion, triglycerides, urinary albumin-to-creatinine ratio