rs816868 chr10:77552356 C>T
- Sequence
agctgtgtgacctcgataagatta[C/T]ttcatcctctgggtctgcttcctc
- ASB in cell types
- periferal blood macrophages HL-60 (acute myeloid leukemia)
- ASB for transcription factors
- SPI1_HUMAN SKI_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.98 | -0.11 | 2.10 | n/a | No Hit | |||
| SKI_HUMAN | 2.41 | n/a | 1.50 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP childhood acute lymphoblastic leukemia, college completion, hdl cholesterol change with statins, rheumatoid arthritis, serum creatinine, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Coronary, Brain_Spinal_cord_cervical_c-1, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid, Whole_Blood