rs817318 chr20:63954909 T>C
- Sequence
tccaggagtgcctttctcaagagc[T/C]ctcagtgcttatctagcgttggcc
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.54 | -0.07 | 1.99 | |||
| K562 (myelogenous leukemia) | 0.61 | -0.22 | 1.98 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Brain_Cortex, Esophagus_Mucosa, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid