rs817385 chr20:63909995 T>C
- Sequence
aaggttttctggaatatttttggt[T/C]gtagtaacgattctgctttaggag
- ASB in cell types
- HEK293 (embryonic kidney) PC9 (lung adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.65 | -0.15 | 1.99 | |||
| PC9 (lung adenocarcinoma) | -0.92 | 1.17 | 1.33 |
Items per page:
1 – 2 of 2