rs818515 chr1:84753686 A>T
- Sequence
acttgaaagggaggacatctcacc[A/T]gcgggggacagcgctgcagaaccc
- ASB in cell types
- HEK293 (embryonic kidney) GM12878 (female B-cells) gastroesophageal sphincter upper lobe of left lung
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.10 | 0.76 | 2.00 | |||
| GM12878 (female B-cells) | 0.69 | 0.37 | 1.33 | |||
| gastroesophageal sphincter | 1.11 | -0.60 | 1.33 | |||
| upper lobe of left lung | 0.73 | -1.11 | 1.33 | |||
| neural cell | 0.49 | -0.14 | 1.00 |
Items per page:
1 – 5 of 6