rs818516 chr1:84753742 A>C
- Sequence
gaacaacagcgacaccaagtggcc[A/C]gtccgcattacccacagcagctgt
- ASB in cell types
- HEK293 (embryonic kidney) MCF7 (Invasive ductal breast carcinoma) liver upper lobe of left lung
- ASB for transcription factors
- GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA1_HUMAN | 1.58 | -1.18 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1