rs818619 chr7:105532058 A>T
- Sequence
agcgaatcccttctctggagctcc[A/T]taggggagggtgcccgcttcctga
- ASB in cell types
- K562 (myelogenous leukemia) foreskin keratinocyte MCF7 (Invasive ductal breast carcinoma) CD14+ monocytes
- ASB for transcription factors
- CTCF_HUMAN STAT1_HUMAN ZN639_HUMAN RING2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.70 | 0.29 | 1.44 | n/a | No Hit | |||
| STAT1_HUMAN | 1.02 | -0.34 | 2.20 | n/a | No Hit | |||
| ZN639_HUMAN | 1.63 | -1.28 | 1.33 | n/a | n/a | |||
| RING2_HUMAN | 1.00 | -1.25 | 1.44 | n/a | n/a | |||
| ZN184_HUMAN | 1.50 | -1.18 | 1.33 | n/a | n/a |
Items per page:
1 – 5 of 6
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid