rs818708 chr9:113387829 G>A
- Sequence
ggaaatgccttccagtggaattgc[G/A]gcaaatttcaactctaacccaggg
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.40 | 0.58 | 1.27 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, paternal transmission distortion, prop taste detection threshold, salmonella-induced pyroptosis, simpson-angus scale, sporadic creutzfeldt-jakob disease, stabilized warfarin dose, transmission distortion
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Breast_Mammary_Tissue, Muscle_Skeletal, Nerve_Tibial, Testis