rs819147 chr20:34301898 C>T
- Sequence
ctctatataacgggattacgtcca[C/T]ctctatgaagattattgtgtaaac
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.21 | 0.91 | 2.03 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), diastolic blood pressure (dbp), obesity (body mass index (bmi)), panic disorder, plasma protein-c levels, triglycerides
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Skin_Sun_Exposed_Lower_leg, Whole_Blood