rs819882 chr1:245390008 G>A
- Sequence
ttatgagatcgaaactattttcat[G/A]taatactccgacgctatctgcctt
- ASB for transcription factors
- FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | -0.08 | 1.28 | 1.67 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP barnes akathisia rating scale, college completion, cystatin c in serum, ldl cholesterol, salmonella-induced pyroptosis, simpson-angus scale, total cholesterol