rs819906 chr1:99295110 G>T
- Sequence
ctatatttttcaaaaagtataaat[G/T]gttaactcagcatccaatggtttg
- ASB for transcription factors
- ZN316_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN316_HUMAN | n/a | 2.07 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, advanced age-related macular degeneration (geographic atrophy), infant head circumference, obesity with early age of onset (age >2), simpson-angus scale