rs820144 chr17:75615742 T>C
- Sequence
tgtccctgtccctggagcagcaga[T/C]gcagcagcggcagcagcaggctcg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.59 | 0.10 | 1.61 | |||
| K562 (myelogenous leukemia) | 0.87 | 0.08 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), mean bilateral hippocampal volume, mean bilateral hippocampal volume (excluding patients with neuropsychiatric disorders)
GTEx eQTL Adipose_Visceral_Omentum, Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Lung, Nerve_Tibial, Pancreas, Pituitary, Testis, Thyroid, Whole_Blood