rs820553 chr3:112751739 C>T
- Sequence
ttatttgaatgcatgtaattgtta[C/T]ttaggtggaatgcctctgctgtaa
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- SP7_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SP7_HUMAN | 2.61 | -3.23 | 1.50 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, coronary artery disease (cad), diabetic retinopathy in type 2 diabetes mellitus, hip bone mineral density (bmd), ldl cholesterol