rs820869 chr5:74684240 C>T
- Sequence
ttttctccttctggtaagagaaca[C/T]ctcttctccctttggcatctccag
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.26 | 0.82 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, body mass index (bmi), fasting insulin, homa-ir, microalbuminuria, urinary albumin-to-creatinine ratio, years of education
GTEx eQTL Adipose_Subcutaneous, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Testis, Thyroid, Whole_Blood