rs822373 chr3:186753397 A>G
- Sequence
ggtgaaggtcttaatgggaagccc[A/G]tggccgctgggagaatgtgtttct
- ASB in cell types
- LNCaP (prostate carcinoma) T47D (invasive ductal carcinoma)
- ASB for transcription factors
- CTCF_HUMAN FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.40 | 0.60 | 1.56 | n/a | No Hit | |||
| FOXA1_HUMAN | -0.05 | 0.78 | 1.95 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP activated partial thromboplastin time, adiponectin levels, asthma, primary rhegmatogenous retinal detachment, sporadic creutzfeldt-jakob disease, urinary albumin-to-creatinine ratio