rs822470 chr5:155310075 G>A
- Sequence
agtatgtccaggaagaatgaccag[G/A]actgtgagagggactctaaactca
- ASB in cell types
- T47D (invasive ductal carcinoma)
- ASB for transcription factors
- FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | -0.07 | 1.32 | 2.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, chronic kidney disease, cystatin c in serum, hdl cholesterol, lp-pla2 activity, lp-pla2 mass