rs823170 chr2:2852610 T>G
- Sequence
cacacacacacacacagaaacaca[T/G]gcataaatgcacaccacatacaca
- ASB in cell types
- HepG2 (hepatoblastoma) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 1.04 | -0.20 | 2.00 | |||
| K562 (myelogenous leukemia) | -0.15 | 0.63 | 1.97 |
Items per page:
1 – 2 of 2