rs823374 chr7:29610031 C>G
- Sequence
aatgtttggttttgtaaatatatt[C/G]ttcttccatggcatggcagtccct
- ASB in cell types
- A549 (lung carcinoma) RWPE2 IPSC-derived bipolar neuron 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | -0.18 | 0.52 | 2.00 | |||
| RWPE2 | -1.12 | 1.25 | 1.00 | |||
| IPSC-derived bipolar neuron | 1.51 | -0.09 | 1.33 | |||
| 22RV1 (prostate carcinoma) | n/a | 1.60 | 2.00 |
Items per page:
1 – 4 of 4