rs8270 chr14:105209364 C>A
- Sequence
agccctcgagaagccctggcagga[C/A]ccaggctggctactgagctctggg
- ASB in cell types
- cranial neural crest cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| cranial neural crest cells | -1.55 | 2.09 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), alzheimers disease, arthritis including non-rheumatoid, body mass index (bmi), obesity with early age of onset (age >2), salmonella-induced pyroptosis, variant creutzfeldt-jakob disease
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Esophagus_Mucosa, Skin_Sun_Exposed_Lower_leg, Thyroid