rs828054 chr1:97144470 G>T
- Sequence
aatctgttcctgctttggtggtct[G/T]gaaagaatgaacagcaatattcat
- ASB in cell types
- LHSAR (prostate epithelial cells)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 0.93 | 0.57 | 1.67 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP autism, chronic kidney disease, hip bone mineral density (bmd), ldl cholesterol, rheumatoid arthritis, sporadic creutzfeldt-jakob disease, systolic blood pressure (sbp)