rs831849 chr5:57119245 T>C
- Sequence
tgtacagatcctttctgcagctag[T/C]gtactgctcagatatggagtcatc
- ASB in cell types
- CD34+ bone marrow cell-derived erythroid progenitors CD34+ hematopoietic stem cells-derived proerythroblasts
- ASB for transcription factors
- TAL1_HUMAN GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TAL1_HUMAN | 2.34 | -2.24 | 1.67 | -1.42 | Weak Concordant | |||
| GATA1_HUMAN | 1.81 | -2.08 | 1.33 | -1.42 | Weak Concordant |
Items per page:
1 – 2 of 2
Motif analysis
