rs833069 chr6:43774842 T>C
- Sequence
gagggctcagcctaatgggatctc[T/C]cctcccttccctggtttgcattcc
- ASB in cell types
- K562 (myelogenous leukemia) foreskin keratinocyte ascending aorta HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.49 | 1.14 | 2.97 | |||
| foreskin keratinocyte | 0.53 | n/a | 2.50 | |||
| ascending aorta | n/a | 2.12 | 1.33 | |||
| HepG2 (hepatoblastoma) | -0.19 | 0.49 | 2.00 | |||
| KMS-11 | n/a | 2.02 | 2.00 |
Items per page:
1 – 5 of 7