rs835044 chr12:95003776 T>C
- Sequence
aggaagcccacgcccagaaggttc[T/C]cacgcgaacgccagacgtggtggc
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia) fetal bone marrow-derived mononuclear cells CD14+ monocytes
- ASB for transcription factors
- NRF1_HUMAN PKNX1_HUMAN STAT1_HUMAN SP7_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NRF1_HUMAN | 0.97 | 0.43 | 1.94 | n/a | No Hit | |||
| PKNX1_HUMAN | 0.75 | n/a | 2.08 | n/a | No Hit | |||
| STAT1_HUMAN | -0.02 | 2.06 | 2.20 | n/a | No Hit | |||
| SP7_HUMAN | n/a | 2.83 | 2.00 | n/a | n/a | |||
| ZFHX2_HUMAN | n/a | 2.56 | 2.00 | n/a | n/a |
Items per page:
1 – 5 of 15
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Testis, Thyroid, Whole_Blood