rs837344 chr13:100533802 T>C
- Sequence
ttacataaagacagaagtgatttg[T/C]gtgaaagtgactcaaacaaaaatg
- ASB in cell types
- HepG2 (hepatoblastoma) LNCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 1.01 | -0.14 | 1.35 | |||
| LNCaP (prostate carcinoma) | 1.11 | 0.77 | 1.80 |
Items per page:
1 – 2 of 2