rs838869 chr12:124767039 T>C
- Sequence
ttagttcatcagtttttcattttt[T/C]atctttgctatgtccagagcctca
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) foreskin keratinocyte GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.33 | 0.74 | 2.02 | |||
| HEK293 (embryonic kidney) | 0.74 | -0.35 | 2.00 | |||
| foreskin keratinocyte | 0.49 | n/a | 2.50 | |||
| GM12878 (female B-cells) | 0.51 | 0.59 | 1.28 |
Items per page:
1 – 4 of 4