rs839027 chr4:57427168 A>T
- Sequence
agaactcgtaggctatagcattat[A/T]ttttgcaagaaatttgtattatag
- ASB in cell types
- foreskin keratinocyte SK-N-SH (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.57 | n/a | 2.67 | |||
| SK-N-SH (neuroblastoma) | 1.19 | -1.48 | 1.33 |
Items per page:
1 – 2 of 2