rs839605 chr1:119674901 C>A
- Sequence
aagttgaaaagccagttgcccgaa[C/A]gtatgtgtaatatgaaaccatttg
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- NFIC_HUMAN MEIS2_HUMAN RING2_HUMAN CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NFIC_HUMAN | 2.70 | -3.05 | 1.33 | n/a | No Hit | |||
| MEIS2_HUMAN | 2.53 | n/a | 1.33 | n/a | No Hit | |||
| RING2_HUMAN | 2.56 | -3.22 | 1.33 | n/a | n/a | |||
| CEBPB_HUMAN | 2.18 | -0.43 | 1.33 | n/a | No Hit | |||
| KDM1A_HUMAN | 1.69 | -1.72 | 1.33 | n/a | n/a |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, diastolic blood pressure (dbp), hdl cholesterol, microalbuminuria, obesity with early age of onset (age >2), systolic blood pressure (sbp), total cholesterol
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis