rs839615 chr1:119712955 C>G
- Sequence
gaccagactcgactagaatccgat[C/G]ccaaacgctcccagatgatttata
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- PRD10_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PRD10_HUMAN | n/a | 2.33 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, diastolic blood pressure (dbp), hdl cholesterol change with statins, height, rheumatoid arthritis, urinary albumin-to-creatinine ratio