rs839753 chr1:43389907 G>C
- Sequence
gttcctgctgggtgccgaggtagc[G/C]aggtcaggggtcaagagtggaaca
- ASB in cell types
- HEK293 (embryonic kidney) Human Umbilical Cord Blood-Derived Erythroid Progenitor Cells-2 (HUDEP-2) HEK293T (embryonic kidney) K562 (myelogenous leukemia)
- ASB for transcription factors
- SP2_HUMAN ZBT26_HUMAN BC11A_HUMAN ZBT8A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SP2_HUMAN | 1.29 | -0.50 | 1.83 | -3.99 | Concordant | |||
| ZBT26_HUMAN | 3.03 | n/a | 2.00 | n/a | n/a | |||
| BC11A_HUMAN | -0.51 | 2.08 | 1.56 | n/a | No Hit | |||
| ZBT8A_HUMAN | 2.73 | n/a | 2.00 | n/a | n/a | |||
| PRD10_HUMAN | 2.42 | -3.68 | 2.00 | n/a | n/a |
Items per page:
1 – 5 of 10
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid