rs840882 chr2:128322453 G>C
- Sequence
cccaggcagcccgcagacgcggca[G/C]gtcttcccaggacccgagggacgc
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.70 | -0.03 | 1.98 | |||
| HEK293 (embryonic kidney) | 0.34 | 0.53 | 1.28 | |||
| GM12878 (female B-cells) | 0.06 | 0.60 | 1.29 |
Items per page:
1 – 3 of 3