rs841116 chr5:87781303 T>A
- Sequence
cactgagatcacagaagagagact[T/A]ctcacaaagccgctagatggcgtg
- ASB in cell types
- HeLa S3 (cervical adenocarcinoma) epidermal keratinocytes
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa S3 (cervical adenocarcinoma) | -0.64 | 1.56 | 2.08 | |||
| epidermal keratinocytes | 1.90 | -1.47 | 2.00 |
Items per page:
1 – 2 of 2